bsk146

Ensembl ID:
ENSDARG00000021660
ZFIN ID:
ZDB-GENE-060313-3
Description:
Serine/threonine-protein kinase SBK1 [Source:UniProtKB/Swiss-Prot;Acc:Q90ZY4]
Human Orthologue:
SBK1
Human Description:
SH3-binding domain kinase 1 [Source:HGNC Symbol;Acc:17699]
Mouse Orthologue:
Sbk1
Mouse Description:
SH3-binding kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2135937]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31849 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31849
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019271 Nonsense 57 385 3 4
ENSDART00000077129   None 385 None 4
ENSDART00000128642 Nonsense 57 385 2 3
Genomic Location (Zv9):
Chromosome 12 (position 563852)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 546037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACCGCGTGTTATGAACCTGAACTTGTTTTTGTCTCCTCATAGGTAGC[A/T]AAATGGCTCTGAAGTTTCTGAAGAAGAAAAGCACCAAGCTGAAGAGCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link