si:dkey-151g10.3

Ensembl ID:
ENSDARG00000021611
ZFIN IDs:
ZDB-GENE-050309-232, ZDB-GENE-090312-81
Human Orthologue:
WNK3
Human Description:
WNK lysine deficient protein kinase 3 [Source:HGNC Symbol;Acc:14543]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6736 Nonsense Mutation detected in F1 DNA During 2017
sa15224 Essential Splice Site Available for shipment Available now
sa501 Nonsense Available for shipment Available now
sa37712 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10232 Nonsense Available for shipment Available now
sa32443 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035702 Nonsense 574 1651 10 37
ENSDART00000132799   None 627 None 8
ENSDART00000136675   None 133 None 3
ENSDART00000140789   None 522 None 7
Genomic Location (Zv9):
Chromosome 23 (position 25492078)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25278198
KASP Assay ID:
554-4991.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AARGTGAGCTGCAACAGCAGGTGTTTATACAGCAACCTCAAAGCAAACCC[C/T]AACAAYAAGTTGGGATACARCCTCAAGTTCAGCAGCATCAGACATCAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15224
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035702 Essential Splice Site 813 1651 16 37
ENSDART00000132799   None 627 None 8
ENSDART00000136675   None 133 None 3
ENSDART00000140789   None 522 None 7
Genomic Location (Zv9):
Chromosome 23 (position 25495958)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25282078
KASP Assay ID:
2261-7790.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTTTGACAYTGAGGGAGATGCACCTGAAGACATTGCAGATTACATGG[T/C]AATATATNTTTTTTAGCTGCTACAGTRATTCATTTGCTTYTTGTGAAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa501
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035702 Nonsense 860 1651 20 37
ENSDART00000132799   None 627 None 8
ENSDART00000136675   None 133 None 3
ENSDART00000140789   None 522 None 7
Genomic Location (Zv9):
Chromosome 23 (position 25496585)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25282705
KASP Assay ID:
554-0219.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACAATGATTAATTTTATATAGTAGCATATGTTGTTCTTTTTATTATTT[C/A]AATTTTTTTGTCACAGACTGGATCCCTGGAGCAGCTCCAAGTGAGCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035702 Essential Splice Site 1384 1651 32 37
ENSDART00000132799   None 627 None 8
ENSDART00000136675   None 133 None 3
ENSDART00000140789   None 522 None 7
Genomic Location (Zv9):
Chromosome 23 (position 25502655)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25288775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACAAGAGTGACAACGCTGTAGCTGTAGTGTGTGCATGGCCAAAATTG[T/A]AATTTTGGCTTTTTTAAATGAGCAGATTTTATTTAGCTTTATTGCATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10232
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035702 Nonsense 1537 1651 35 37
ENSDART00000132799 Nonsense 358 627 5 8
ENSDART00000136675   None 133 None 3
ENSDART00000140789   None 522 None 7
Genomic Location (Zv9):
Chromosome 23 (position 25507545)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25293665
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGARCTACAGGATTTGTACAAGCAGCTCCGCTCTCTCAAAGACCACAGA[C/T]AGCCAATGTCYATGAGCCTKTCCCGCACCTCTCCTCTGCCCTCCGCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32443
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035702 Nonsense 1633 1651 37 37
ENSDART00000132799 Nonsense 481 627 7 8
ENSDART00000136675   None 133 None 3
ENSDART00000140789   None 522 None 7
Genomic Location (Zv9):
Chromosome 23 (position 25508577)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25294697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGTCAAAGGAAACTGTTTGTCCAGTTCAGCCCAAGCCTTCGCTGAAT[C/T]AGATTAAACAGATCCAACAAGTGCAGGAGTTGGGTGGATGGAGCCAGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link