lhfpl3

Ensembl ID:
ENSDARG00000021595
ZFIN ID:
ZDB-GENE-040801-180
Description:
Lipoma HMGIC fusion partner-like 3 protein [Source:UniProtKB/Swiss-Prot;Acc:Q6DHB5]
Human Orthologue:
LHFPL3
Human Description:
lipoma HMGIC fusion partner-like 3 [Source:HGNC Symbol;Acc:6589]
Mouse Orthologue:
Lhfpl3
Mouse Description:
lipoma HMGIC fusion partner-like 3 Gene [Source:MGI Symbol;Acc:MGI:1925076]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20275 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039277 Essential Splice Site None 216 4 4
Genomic Location:
Chromosome 4 (position 21354181)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGAGCTTCAATGTTTATTCACATTAAATCATCCCCTTTATCTGTTCCC[A/T]GGTGTTTCTGTCTTGTTTAAGGAAAACCATTATGTGAAATCACAATCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z0nwn27m