magi2

Ensembl ID:
ENSDARG00000021590
ZFIN ID:
ZDB-GENE-050810-4
Description:
membrane-associated guanylate kinase, WW and PDZ domain-containing protein 2 [Source:RefSeq peptide
Human Orthologue:
MAGI2
Human Description:
membrane associated guanylate kinase, WW and PDZ domain containing 2 [Source:HGNC Symbol;Acc:18957]
Mouse Orthologue:
Magi2
Mouse Description:
membrane associated guanylate kinase, WW and PDZ domain containing 2 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17077 Nonsense Available for shipment Available now
sa9085 Nonsense Mutation detected in F1 DNA During 2014
sa18564 Nonsense Available for shipment Available now
sa20277 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17077
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009768 Nonsense 15 1140 1 20
ENSDART00000133644 Nonsense 149 1274 3 22
Genomic Location:
Chromosome 4 (position 21814320)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGTACAACCAGGCAGCCCAGAGAAGGAGAAGTTCCTGGAGTAGACTA[T/A]AATTTTGTGACCGTTGAGCGTTTTGTGGAGTTAGAGAGAAGTGGAGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009768 Nonsense 72 1140 2 20
ENSDART00000133644 Nonsense 206 1274 4 22
Genomic Location:
Chromosome 4 (position 21809061)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGCTGAATGTAGCAGAGCAGCTGCTGCCCGGAGCAACACCCACATCA[C/T]AGGGCAAAYGCAGRCGCAACAAGTCCGTCAGCAACATGGAGAAGGCTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009768 Nonsense 309 1140 7 20
ENSDART00000133644 Nonsense 443 1274 9 22
Genomic Location:
Chromosome 4 (position 21767465)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGATTTGGCTTCACTATCATTGGCGGTGATGAACCWGATGAGTTTCTA[C/T]AGGTCAAAAGTGTCATACYGGACGGGCCTGCAGCACAGGATGGCAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009768 Nonsense 535 1140 9 20
ENSDART00000133644 Nonsense 669 1274 11 22
Genomic Location:
Chromosome 4 (position 21738228)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTTGTTTCCCTCTTTAAATTTAAAGATCCAGCAGGTTTCAAGTTTTG[T/A]TCTTTTACATTGCAGGTCACTTTTCCCCTTGGAAGACCACTAAACAGGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wonxs4fm