zgc:55318

Ensembl ID:
ENSDARG00000021584
ZFIN ID:
ZDB-GENE-030131-5640
Description:
Contactin-5 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZW34]
Human Orthologue:
CNTN5
Human Description:
contactin 5 [Source:HGNC Symbol;Acc:2175]
Mouse Orthologue:
Cntn5
Mouse Description:
contactin 5 Gene [Source:MGI Symbol;Acc:MGI:3042287]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36716 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17204 Nonsense Available for shipment Available now
sa25072 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034225 Essential Splice Site 135 601 4 13
ENSDART00000098639 Essential Splice Site 343 1114 9 24
ENSDART00000098641 Essential Splice Site 285 936 7 23
ENSDART00000124211   None 305 None 6
Genomic Location (Zv9):
Chromosome 18 (position 40667818)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 42277398
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTTATGTTTTGTATTTATTATTATTTATAAATTTACTTTTTGTCTTC[A/T]GTCCTGTCCCCACAATCACCTGGAGGAAGATGAGTGGAAACATTCCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17204
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034225 Nonsense 318 601 7 13
ENSDART00000098639 Nonsense 526 1114 12 24
ENSDART00000098641 Nonsense 468 936 10 23
ENSDART00000124211   None 305 None 6
Genomic Location (Zv9):
Chromosome 18 (position 40639265)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 42248845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGGAAAGACGTGTCTCTAGAGTGCCGTCCTCGTGCTTCACCCAAACCC[A/T]GAATCTCATGGAGGAAAAACGACCGAAGACTTCAACCCAGCCGAAGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034225 Nonsense 468 601 10 13
ENSDART00000098639 Nonsense 676 1114 15 24
ENSDART00000098641 Nonsense 618 936 13 23
ENSDART00000124211   None 305 None 6
Genomic Location (Zv9):
Chromosome 18 (position 40597761)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 42207341
KASP Assay ID:
554-7795.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGAAATATGGCTGTCGAGCTCAGACCAGCGCTGACAGTGTGCTTGCT[G/T]AAGCTGAGCTGCTGGTGCGAGGTGAGTACAATTCAGGAAAATTCATAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link