orc5

Ensembl ID:
ENSDARG00000021579
ZFIN ID:
ZDB-GENE-040426-2275
Description:
origin recognition complex subunit 5 [Source:RefSeq peptide;Acc:NP_998363]
Human Orthologue:
ORC5
Human Description:
origin recognition complex, subunit 5 [Source:HGNC Symbol;Acc:8491]
Mouse Orthologue:
Orc5
Mouse Description:
origin recognition complex, subunit 5 Gene [Source:MGI Symbol;Acc:MGI:1347044]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33464 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037670 Essential Splice Site 156 444 5 15
Genomic Location (Zv9):
Chromosome 4 (position 21295784)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22639119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATATGGATTTCAGCCTGCTTCCTGCTCTTCTGCGCCTACAGGAACTG[G/T]TACACACACACACACACACACACACACACTCAATTTTGCTAATGCTTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link