si:ch211-12a5.1

Ensembl ID:
ENSDARG00000021572
ZFIN ID:
ZDB-GENE-090313-23
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A608]
Human Orthologue:
C6orf150
Human Description:
chromosome 6 open reading frame 150 [Source:HGNC Symbol;Acc:21367]
Mouse Orthologue:
E330016A19Rik
Mouse Description:
RIKEN cDNA E330016A19 gene Gene [Source:MGI Symbol;Acc:MGI:2442261]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13666 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13666
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037585 Nonsense 270 371 5 6
ENSDART00000140085 Nonsense 179 270 4 4
Genomic Location (Zv9):
Chromosome 13 (position 27555948)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27201608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYCACCCTTTCAGGAAAGAGTGTCTAAAACTTCTRAAGTATCTTCTACAA[C/T]AGCTCAAAAATGATGAGTCCAAATCCAATAAGATGTCCAGCTTCTGCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link