gdap2

Ensembl ID:
ENSDARG00000021569
ZFIN ID:
ZDB-GENE-040912-31
Description:
Ganglioside-induced differentiation-associated protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q66HX8]
Human Orthologue:
GDAP2
Human Description:
ganglioside induced differentiation associated protein 2 [Source:HGNC Symbol;Acc:18010]
Mouse Orthologue:
Gdap2
Mouse Description:
ganglioside-induced differentiation-associated-protein 2 Gene [Source:MGI Symbol;Acc:MGI:1338001]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34609 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34609
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028247 Nonsense 308 504 8 14
ENSDART00000124301 Nonsense 308 504 8 16
ENSDART00000133321 Nonsense 308 491 8 13
Genomic Location (Zv9):
Chromosome 9 (position 21871284)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21027070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGAAGTCATGCCTTTGCTCGTATGGAAGGAGATGTGGATAAGCAACGG[A/T]AACTCATCCTTCAGGGGCAGATGTCTGAAGTAGCCCAGCAGAAACAACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link