rad23b

Ensembl ID:
ENSDARG00000021550
ZFIN ID:
ZDB-GENE-040426-1487
Description:
UV excision repair protein RAD23 homolog B [Source:RefSeq peptide;Acc:NP_956858]
Human Orthologue:
RAD23B
Human Description:
RAD23 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:9813]
Mouse Orthologue:
Rad23b
Mouse Description:
RAD23b homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:105128]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23832 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23832
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124615 Nonsense 48 381 2 10
Genomic Location (Zv9):
Chromosome 21 (position 584649)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 442862
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGAAAAGGGAAAAGACGGGTTTCCAGTGGCGGGACAGAAGTTGATATA[C/A]GCAGGTGAGTCCTTTTTTCACCCGTTTCCACTGAGTGGTACAGTACATGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer: Novel breast cancer susceptibility locus at 9q31.2: results of a genome-wide association study. (View Study)
  • Prostate cancer: Genome-wide association study in Chinese men identifies two new prostate cancer risk loci at 9q31.2 and 19q13.4. (View Study)
  • Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link