tab2

Ensembl ID:
ENSDARG00000021509
ZFIN ID:
ZDB-GENE-040426-933
Description:
TGF-beta-activated kinase 1 and MAP3K7-binding protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q5RFW2]
Human Orthologue:
TAB2
Human Description:
TGF-beta activated kinase 1/MAP3K7 binding protein 2 [Source:HGNC Symbol;Acc:17075]
Mouse Orthologue:
Tab2
Mouse Description:
TGF-beta activated kinase 1/MAP3K7 binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1915902]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6611 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017791 Nonsense 31 711 2 7
ENSDART00000064436 Nonsense 31 285 2 4
ENSDART00000136669 Nonsense 31 285 2 4
ENSDART00000137031 Nonsense 31 711 1 6
Genomic Location:
Chromosome 20 (position 1360435)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCTGCGGCAAAAGTTTCCAGAAGTACCAGAGGACGTGGTGTGTGAGTG[T/A]GTCCTACAGGTGAGAGCTGCTCTGCACAAACWCTGGCTGGATGAGGGYCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o4r3scbl