
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tab2
- Ensembl ID:
- ENSDARG00000021509
- ZFIN ID:
- ZDB-GENE-040426-933
- Description:
- TGF-beta-activated kinase 1 and MAP3K7-binding protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q5RFW2]
- Human Orthologue:
- TAB2
- Human Description:
- TGF-beta activated kinase 1/MAP3K7 binding protein 2 [Source:HGNC Symbol;Acc:17075]
- Mouse Orthologue:
- Tab2
- Mouse Description:
- TGF-beta activated kinase 1/MAP3K7 binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1915902]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6611 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa36936 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa36937 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa6611
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017791 | Nonsense | 31 | 711 | 2 | 7 |
ENSDART00000064436 | Nonsense | 31 | 285 | 2 | 4 |
ENSDART00000136669 | Nonsense | 31 | 285 | 2 | 4 |
ENSDART00000137031 | Nonsense | 31 | 711 | 1 | 6 |
- Genomic Location (Zv9):
- Chromosome 20 (position 1360435)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 1316300 GRCz11 20 1337126 - KASP Assay ID:
- 554-5173.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CACCTGCGGCAAAAGTTTCCAGAAGTACCAGAGGACGTGGTGTGTGAGTG[T/A]GTCCTACAGGTGAGAGCTGCTCTGCACAAACWCTGGCTGGATGAGGGYCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36936
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017791 | Nonsense | 55 | 711 | 3 | 7 |
ENSDART00000064436 | Nonsense | 55 | 285 | 3 | 4 |
ENSDART00000136669 | Nonsense | 55 | 285 | 3 | 4 |
ENSDART00000137031 | Nonsense | 55 | 711 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 20 (position 1362123)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 1317988 GRCz11 20 1338814 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGGCTGCGTGCTGCGAGTATCTGACCAAGGTGAGCCCTCGTTTCCTGTA[C/A]AGTGAAGGCAGCCAGAGTTTGACAGATCTCCGCAATCACATGACCCAGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36937
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017791 | Nonsense | 206 | 711 | 3 | 7 |
ENSDART00000064436 | Nonsense | 206 | 285 | 3 | 4 |
ENSDART00000136669 | Nonsense | 206 | 285 | 3 | 4 |
ENSDART00000137031 | Nonsense | 206 | 711 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 20 (position 1362574)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 1318439 GRCz11 20 1339265 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTCGGGTCTGAACAGTCCCAACTCCATCTATATTCGGCCCTACGTGACA[C/T]AGCCAGGCTCGACCCGTCAGGTGCAATGCCGAGCGCAGTACAGCCCCACA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Breast cancer: Genome-wide association study in east Asians identifies novel susceptibility loci for breast cancer. (View Study)
- Dupuytren's disease: Wnt signaling and Dupuytren's disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: