tab2

Ensembl ID:
ENSDARG00000021509
ZFIN ID:
ZDB-GENE-040426-933
Description:
TGF-beta-activated kinase 1 and MAP3K7-binding protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q5RFW2]
Human Orthologue:
TAB2
Human Description:
TGF-beta activated kinase 1/MAP3K7 binding protein 2 [Source:HGNC Symbol;Acc:17075]
Mouse Orthologue:
Tab2
Mouse Description:
TGF-beta activated kinase 1/MAP3K7 binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1915902]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6611 Nonsense Mutation detected in F1 DNA During 2016
sa36936 Nonsense Mutation detected in F1 DNA During 2016
sa36937 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017791 Nonsense 31 711 2 7
ENSDART00000064436 Nonsense 31 285 2 4
ENSDART00000136669 Nonsense 31 285 2 4
ENSDART00000137031 Nonsense 31 711 1 6
Genomic Location:
Chromosome 20 (position 1360435)
KASP Assay ID:
554-5173.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCTGCGGCAAAAGTTTCCAGAAGTACCAGAGGACGTGGTGTGTGAGTG[T/A]GTCCTACAGGTGAGAGCTGCTCTGCACAAACWCTGGCTGGATGAGGGYCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36936
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017791 Nonsense 55 711 3 7
ENSDART00000064436 Nonsense 55 285 3 4
ENSDART00000136669 Nonsense 55 285 3 4
ENSDART00000137031 Nonsense 55 711 2 6
Genomic Location:
Chromosome 20 (position 1362123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGCTGCGTGCTGCGAGTATCTGACCAAGGTGAGCCCTCGTTTCCTGTA[C/A]AGTGAAGGCAGCCAGAGTTTGACAGATCTCCGCAATCACATGACCCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36937
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017791 Nonsense 206 711 3 7
ENSDART00000064436 Nonsense 206 285 3 4
ENSDART00000136669 Nonsense 206 285 3 4
ENSDART00000137031 Nonsense 206 711 2 6
Genomic Location:
Chromosome 20 (position 1362574)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCGGGTCTGAACAGTCCCAACTCCATCTATATTCGGCCCTACGTGACA[C/T]AGCCAGGCTCGACCCGTCAGGTGCAATGCCGAGCGCAGTACAGCCCCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link