LOC797380

Ensembl ID:
ENSDARG00000021497
Human Orthologue:
GPR132
Human Description:
G protein-coupled receptor 132 [Source:HGNC Symbol;Acc:17482]
Mouse Orthologue:
Gpr132
Mouse Description:
G protein-coupled receptor 132 Gene [Source:MGI Symbol;Acc:MGI:1890220]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36488 Nonsense Mutation detected in F1 DNA During 2016
sa23150 Nonsense Mutation detected in F1 DNA During 2016
sa7837 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36488
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032410 Nonsense 50 314 1 1
Genomic Location:
Chromosome 17 (position 39928457)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCGGCAAACCTGATCACAGTCTTCCTCACGTTCCTCGAAGTGTGTCGG[A/T]AGAACGTTCTAGGAGTGTACCTCTTCAGCCTGACACTGTGTGACCTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23150
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032410 Nonsense 86 314 1 1
Genomic Location:
Chromosome 17 (position 39928347)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTTCCACTGTGGGCCATTTACATCCACAGAGGCCATCGCTGGGAATG[G/A]GGCTCTCTGGCCTGCAAGATCACCGGATACGTGTTTTTCAATAACATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032410 Nonsense 184 314 1 1
Genomic Location:
Chromosome 17 (position 39928053)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGTTTCGAGCCGAGCAATCCTTCTTCTGTAGTGACAGGACTCAATTA[T/A]GCTCGATTCTTTGTTGGTTTCTTCATCCCGTTGTGCATTTTAACTCTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link