LOC797380

Ensembl ID:
ENSDARG00000021497
Human Orthologue:
GPR132
Human Description:
G protein-coupled receptor 132 [Source:HGNC Symbol;Acc:17482]
Mouse Orthologue:
Gpr132
Mouse Description:
G protein-coupled receptor 132 Gene [Source:MGI Symbol;Acc:MGI:1890220]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23150 Nonsense Mutation detected in F1 DNA During 2014
sa7837 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23150
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032410 Nonsense 86 314 1 1
Genomic Location:
Chromosome 17 (position 39928347)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTTCCACTGTGGGCCATTTACATCCACAGAGGCCATCGCTGGGAATG[G/A]GGCTCTCTGGCCTGCAAGATCACCGGATACGTGTTTTTCAATAACATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032410 Nonsense 184 314 1 1
Genomic Location:
Chromosome 17 (position 39928053)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGTTTCGAGCCGAGCAATCCTTCTTCTGTAGTGACAGGACTCAATTA[T/A]GCTCGATTCTTTGTTGGTTTCTTCATCCCGTTGTGCATTTTAACTCTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b2jlh877