hnf4a

Ensembl ID:
ENSDARG00000021494
ZFIN ID:
ZDB-GENE-030131-1077
Description:
hepatocyte nuclear factor 4-alpha [Source:RefSeq peptide;Acc:NP_919349]
Human Orthologue:
HNF4A
Human Description:
hepatocyte nuclear factor 4, alpha [Source:HGNC Symbol;Acc:5024]
Mouse Orthologue:
Hnf4a
Mouse Description:
hepatic nuclear factor 4, alpha Gene [Source:MGI Symbol;Acc:MGI:109128]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43991 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028236 Splice Site, Nonsense 216 463 5 11
ENSDART00000122938 Splice Site, Nonsense 180 427 6 11
ENSDART00000124103 Splice Site None 42 6 11
ENSDART00000138907 Splice Site, Nonsense 194 274 5 7
ENSDART00000145426 Splice Site, Nonsense 216 463 5 10

The following transcripts of ENSDARG00000021494 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 26148100)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25934220
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAATGGGCAAAATACATCCCTGCATTCTGCGACCTCCCGCTGGATGAT[C/T]AGGTAGGACAAGTTCCTCTTATTTATCTACAAATGTGTCCTTGCAATATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • C-reactive protein: Genome-wide association and population genetic analysis of C-reactive protein in African American and Hispanic American women. (View Study)
  • C-reactive protein: Meta-analysis of genome-wide association studies in >80 000 subjects identifies multiple loci for C-reactive protein levels. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
  • Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)
  • Type 2 diabetes: Genome-wide association study in individuals of South Asian ancestry identifies six new type 2 diabetes susceptibility loci. (View Study)
  • Type 2 diabetes: Meta-analysis of genome-wide association studies identifies eight new loci for type 2 diabetes in east Asians. (View Study)
  • Ulcerative colitis: Genome-wide association study of ulcerative colitis identifies three new susceptibility loci, including the HNF4A region. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link