cdc14b

Ensembl ID:
ENSDARG00000021483
ZFIN IDs:
ZDB-GENE-040426-820, ZDB-GENE-040426-820
Description:
dual specificity protein phosphatase CDC14B [Source:RefSeq peptide;Acc:NP_956473]
Human Orthologue:
CDC14B
Human Description:
CDC14 cell division cycle 14 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:1719]
Mouse Orthologue:
Cdc14b
Mouse Description:
CDC14 cell division cycle 14 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2441808]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21171 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123896 Nonsense 393 465 12 15
ENSDART00000128870 Nonsense 332 404 12 15
Genomic Location:
Chromosome 8 (position 1322362)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGAATGTGTTTTAATTGTTCAGCACACTGAAGAAGAAGAAGAGGACTG[T/A]GCTGGACTCACACAAGGTGACAAACTGCGAGCTCTGAAGAGCAAAAGGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/50ugcw8y