si:ch211-267e7.7

Ensembl ID:
ENSDARG00000021480
ZFIN ID:
ZDB-GENE-070912-266
Description:
LOC567907 protein [Source:UniProtKB/TrEMBL;Acc:A7MBT4]
Human Orthologue:
OLFML2B
Human Description:
olfactomedin-like 2B [Source:HGNC Symbol;Acc:24558]
Mouse Orthologue:
Olfml2b
Mouse Description:
olfactomedin-like 2B Gene [Source:MGI Symbol;Acc:MGI:2443310]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19726 Essential Splice Site, Missense Available for shipment Available now
sa11701 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19726
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010370 Essential Splice Site 225 466 4 7
ENSDART00000128505 Missense 195 679 4 10
ENSDART00000131501   None 258 None 2
ENSDART00000135558   None 150 None 3
Genomic Location (Zv9):
Chromosome 2 (position 20378007)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20950617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGCCTTCACTGCAGAAGAACGCAGCAGCGGCTTTTGCTCACACTGAG[G/A]TACAGATGCAGTATATTCTAGCACGATCTTTTAGAAGAGCCTAAATGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010370   None 466 None 7
ENSDART00000128505 Nonsense 524 679 9 10
ENSDART00000131501   103 258 2 2
ENSDART00000135558   None 150 None 3
Genomic Location (Zv9):
Chromosome 2 (position 20383650)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20956260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAGAGCTTTTTCTCGWGATATAATCAGGTTTGATCTTCGTCTCCGGTA[T/A]GYTGCAGCCTGGACCACCCTTCATGACGCAATATTAGAGGAGGAGGAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • C-reactive protein: Genome-wide association and population genetic analysis of C-reactive protein in African American and Hispanic American women. (View Study)
  • QT interval: Common genetic variation near the phospholamban gene is associated with cardiac repolarisation: meta-analysis of three genome-wide association studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link