
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-267e7.7
- Ensembl ID:
- ENSDARG00000021480
- ZFIN ID:
- ZDB-GENE-070912-266
- Description:
- LOC567907 protein [Source:UniProtKB/TrEMBL;Acc:A7MBT4]
- Human Orthologue:
- OLFML2B
- Human Description:
- olfactomedin-like 2B [Source:HGNC Symbol;Acc:24558]
- Mouse Orthologue:
- Olfml2b
- Mouse Description:
- olfactomedin-like 2B Gene [Source:MGI Symbol;Acc:MGI:2443310]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa45097 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa19726 | Essential Splice Site, Missense | Available for shipment | Available now |
sa11701 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa45097
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010370 | Nonsense | 3 | 466 | 1 | 7 |
ENSDART00000128505 | None | 679 | None | 10 | |
ENSDART00000131501 | None | 258 | None | 2 | |
ENSDART00000135558 | None | 150 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 2 (position 20374611)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 20947221 GRCz11 2 20605193 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAACTGAGATTGTTCTTGCAGCTCTTCTTGAGGAATCTTCATAATGGGAT[T/A]ACTGTTATATATTTTTTGCTGTGTTTTTTGTTTGACACGCGCCAATGTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19726
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site, Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010370 | Essential Splice Site | 225 | 466 | 4 | 7 |
ENSDART00000128505 | Missense | 195 | 679 | 4 | 10 |
ENSDART00000131501 | None | 258 | None | 2 | |
ENSDART00000135558 | None | 150 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 2 (position 20378007)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 20950617 GRCz11 2 20608589 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGAGCCTTCACTGCAGAAGAACGCAGCAGCGGCTTTTGCTCACACTGAG[G/A]TACAGATGCAGTATATTCTAGCACGATCTTTTAGAAGAGCCTAAATGGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11701
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010370 | None | 466 | None | 7 | |
ENSDART00000128505 | Nonsense | 524 | 679 | 9 | 10 |
ENSDART00000131501 | 103 | 258 | 2 | 2 | |
ENSDART00000135558 | None | 150 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 2 (position 20383650)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 20956260 GRCz11 2 20614232 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AATAGAGCTTTTTCTCGWGATATAATCAGGTTTGATCTTCGTCTCCGGTA[T/A]GYTGCAGCCTGGACCACCCTTCATGACGCAATATTAGAGGAGGAGGAGGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- C-reactive protein: Genome-wide association and population genetic analysis of C-reactive protein in African American and Hispanic American women. (View Study)
- QT interval: Common genetic variation near the phospholamban gene is associated with cardiac repolarisation: meta-analysis of three genome-wide association studies. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: