si:ch211-267e7.7

Ensembl ID:
ENSDARG00000021480
ZFIN ID:
ZDB-GENE-070912-266
Description:
LOC567907 protein [Source:UniProtKB/TrEMBL;Acc:A7MBT4]
Human Orthologue:
OLFML2B
Human Description:
olfactomedin-like 2B [Source:HGNC Symbol;Acc:24558]
Mouse Orthologue:
Olfml2b
Mouse Description:
olfactomedin-like 2B Gene [Source:MGI Symbol;Acc:MGI:2443310]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45097 Nonsense Mutation detected in F1 DNA During 2018
sa19726 Essential Splice Site, Missense Available for shipment Available now
sa11701 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010370 Nonsense 3 466 1 7
ENSDART00000128505   None 679 None 10
ENSDART00000131501   None 258 None 2
ENSDART00000135558   None 150 None 3
Genomic Location (Zv9):
Chromosome 2 (position 20374611)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20947221
GRCz11 2 20605193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACTGAGATTGTTCTTGCAGCTCTTCTTGAGGAATCTTCATAATGGGAT[T/A]ACTGTTATATATTTTTTGCTGTGTTTTTTGTTTGACACGCGCCAATGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19726
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010370 Essential Splice Site 225 466 4 7
ENSDART00000128505 Missense 195 679 4 10
ENSDART00000131501   None 258 None 2
ENSDART00000135558   None 150 None 3
Genomic Location (Zv9):
Chromosome 2 (position 20378007)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20950617
GRCz11 2 20608589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGCCTTCACTGCAGAAGAACGCAGCAGCGGCTTTTGCTCACACTGAG[G/A]TACAGATGCAGTATATTCTAGCACGATCTTTTAGAAGAGCCTAAATGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010370   None 466 None 7
ENSDART00000128505 Nonsense 524 679 9 10
ENSDART00000131501   103 258 2 2
ENSDART00000135558   None 150 None 3
Genomic Location (Zv9):
Chromosome 2 (position 20383650)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20956260
GRCz11 2 20614232
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAGAGCTTTTTCTCGWGATATAATCAGGTTTGATCTTCGTCTCCGGTA[T/A]GYTGCAGCCTGGACCACCCTTCATGACGCAATATTAGAGGAGGAGGAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • C-reactive protein: Genome-wide association and population genetic analysis of C-reactive protein in African American and Hispanic American women. (View Study)
  • QT interval: Common genetic variation near the phospholamban gene is associated with cardiac repolarisation: meta-analysis of three genome-wide association studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link