si:ch211-232m7.1

Ensembl ID:
ENSDARG00000021455
ZFIN ID:
ZDB-GENE-030729-18
Description:
Sb:cb627 protein [Source:UniProtKB/TrEMBL;Acc:A4QN46]
Human Orthologue:
STRBP
Human Description:
spermatid perinuclear RNA binding protein [Source:HGNC Symbol;Acc:16462]
Mouse Orthologue:
Strbp
Mouse Description:
spermatid perinuclear RNA binding protein Gene [Source:MGI Symbol;Acc:MGI:104626]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27567 Essential Splice Site Mutation detected in F1 DNA During 2017
sa1941 Nonsense F2 line generated During 2017
sa34855 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34854 Nonsense Mutation detected in F1 DNA During 2017
sa41598 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031880 Essential Splice Site 146 658 5 18
ENSDART00000129151 Essential Splice Site 146 690 5 19
ENSDART00000130734 Essential Splice Site 146 690 3 17
ENSDART00000132375 Essential Splice Site 146 161 5 6

The following transcripts of ENSDARG00000021455 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 9861116)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9936982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGACTTTGCTGAGCACCGTCTGTGAGCACCTCCCACAGCAGATTGAGG[T/A]AATGGCACACACCTGCCGATAGAAAAGACACATGAGCAAGTCAAGCTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1941
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031880 Nonsense 153 658 6 18
ENSDART00000129151 Nonsense 153 690 6 19
ENSDART00000130734 Nonsense 153 690 4 17
ENSDART00000132375 Nonsense 153 161 6 6

The following transcripts of ENSDARG00000021455 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 9850323)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9926189
KASP Assay ID:
554-1929.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTRCACTTTTACCCTCTGACCTCTGCAGAAGCTGACGGAGGAGAAGTA[T/A]GAGGTACAGCAGTGTATTCCTGAGGCCGCCATCTTAGTCTGCACCACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031880 Essential Splice Site 195 658 6 18
ENSDART00000129151 Essential Splice Site 195 690 6 19
ENSDART00000130734 Essential Splice Site 195 690 4 17
ENSDART00000132375   None 161 None 6

The following transcripts of ENSDARG00000021455 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 9850197)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9926063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCTCACCTCTCCGCAGTTTAAAGACGACTGTGAGACCGAGGAGCAAGG[T/C]TTGCGGTTTCTGTCTTTTCTTTTTTTTTCTTAGCAGGAGGTGAGGGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031880 Nonsense 259 658 9 18
ENSDART00000129151 Nonsense 259 690 9 19
ENSDART00000130734 Nonsense 259 690 7 17
ENSDART00000132375   None 161 None 6

The following transcripts of ENSDARG00000021455 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 9836251)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9912117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAATGAATTAGTCTTTGACAGATGACTTGCTCTTTTGTCCACAGCCTT[T/A]GGAGTTAATATGCGAAAAGGCCATTGCCACATGTAACAGACCTCTGGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031880 Nonsense 656 658 18 18
ENSDART00000129151 Nonsense 656 690 18 19
ENSDART00000130734 Nonsense 656 690 16 17
ENSDART00000132375   None 161 None 6

The following transcripts of ENSDARG00000021455 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 9809942)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9885808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACTCTTGCACTTCACCGTTCTCACAGGCTTCGGAGCCCCATACGGGTA[C/A]AGCGCAGCGGCCGCCACTCCTGCATACGGTACGTACCCCTTCCTTCCCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link