cdh11

Ensembl ID:
ENSDARG00000021442
ZFIN ID:
ZDB-GENE-980526-170
Description:
cadherin-11 [Source:RefSeq peptide;Acc:NP_571289]
Human Orthologue:
CDH11
Human Description:
cadherin 11, type 2, OB-cadherin (osteoblast) [Source:HGNC Symbol;Acc:1750]
Mouse Orthologue:
Cdh11
Mouse Description:
cadherin 11 Gene [Source:MGI Symbol;Acc:MGI:99217]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27024 Missense Mutation detected in F1 DNA During 2016
sa14413 Nonsense Available for shipment Available now
sa31589 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa27024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002279 Missense 206 800 3 11
ENSDART00000127332 Missense 203 797 3 11

The following transcripts of ENSDARG00000021442 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 44758418)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGCTACAGACGCAGATGACCCCACATATGGTAACAGCGCCAGACTGG[T/G]CTACAGCATCCTGCAGGGCCAGCCTTATTTTTCTGTGGAGCCGCAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002279 Nonsense 454 800 7 11
ENSDART00000127332 Nonsense 451 797 7 11

The following transcripts of ENSDARG00000021442 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 44751416)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTTCACCATTAATCCTGAGGACGGCATAATTAAGACCACAAGGCCTT[T/A]AGATCGGGAAGCACAGGCTTGGCACAAYATTTCTGTCAGCGCTACAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31589
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002279 Nonsense 785 800 11 11
ENSDART00000127332 Nonsense 782 797 11 11

The following transcripts of ENSDARG00000021442 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 44734871)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAGACCTGGACTATGATTACCTCCAAAGTTGGGGGCCACGCTTCAAG[A/T]AACTAGCCGATCTTTACGGCACCAAAGACTCCGTCGATGACAACTCTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link