asmtl

Ensembl ID:
ENSDARG00000021433
ZFIN ID:
ZDB-GENE-030131-2854
Description:
N-acetylserotonin O-methyltransferase-like protein [Source:RefSeq peptide;Acc:NP_998676]
Human Orthologue:
ASMTL
Human Description:
acetylserotonin O-methyltransferase-like [Source:HGNC Symbol;Acc:751]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8692 Nonsense Mutation detected in F1 DNA During 2014
sa13163 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011163 Nonsense 23 632 2 14
ENSDART00000129543 Nonsense 61 670 2 14

The following transcripts of ENSDARG00000021433 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 35852621)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATATCCAAGCTAAGTGGAAAGCTGGTTGTTCTGGCAAGCGCATCTCCA[C/T]GACGCCTGGAGATTTTATCAAATGCTGTAAGTRTTGCTTTAGTTTTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13163
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011163 Essential Splice Site 31 632 None 14
ENSDART00000129543 Essential Splice Site 69 670 None 14

The following transcripts of ENSDARG00000021433 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 35852593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCTGGCAAGCGCATCTCCAYGACGCCTGGAGATTTTATCAAATGCTG[T/A]AAGTRTTGCTTTAGTTTTGTATTTGTATGTTTTCACAAAGGCAATGAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8j6aaigq