odf3l2

Ensembl ID:
ENSDARG00000021432
ZFIN ID:
ZDB-GENE-080723-64
Description:
outer dense fiber of sperm tails 3-like 2 [Source:RefSeq peptide;Acc:NP_001124142]
Human Orthologue:
ODF3L2
Human Description:
outer dense fiber of sperm tails 3-like 2 [Source:HGNC Symbol;Acc:26841]
Mouse Orthologue:
Odf3l2
Mouse Description:
outer dense fiber of sperm tails 3-like 2 Gene [Source:MGI Symbol;Acc:MGI:2686003]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37505 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023521 Nonsense 130 252 4 4
Genomic Location (Zv9):
Chromosome 22 (position 21632918)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21286166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACCCATCGCAAGCCGCCATCCTACACCATGGGTTACCGTACTCAGTA[T/G]CGCTCCATTGATGCTGTGCCGGCCCCAAACAAATACACGCTTCCTTCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link