kdelc2

Ensembl ID:
ENSDARG00000021408
ZFIN ID:
ZDB-GENE-060810-142
Description:
KDEL (Lys-Asp-Glu-Leu) containing 2 [Source:RefSeq peptide;Acc:NP_001092215]
Human Orthologue:
KDELC2
Human Description:
KDEL (Lys-Asp-Glu-Leu) containing 2 [Source:HGNC Symbol;Acc:28496]
Mouse Orthologue:
Kdelc2
Mouse Description:
KDEL (Lys-Asp-Glu-Leu) containing 2 Gene [Source:MGI Symbol;Acc:MGI:1923765]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37354 Nonsense Mutation detected in F1 DNA During 2017
sa23997 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021645 Nonsense 421 518 6 8
Genomic Location (Zv9):
Chromosome 21 (position 34017413)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35017106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCATACTACGAGCACTTTTACACACATCTGAAACCAGGTGTACACTA[C/A]ATTCCTGTGAAGAGGGACCTTTCTGACCTCATCGAGAAGATTAAATGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23997
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021645 Essential Splice Site 439 518 6 8
Genomic Location (Zv9):
Chromosome 21 (position 34017469)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35017162
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGAAGAGGGACCTTTCTGACCTCATCGAGAAGATTAAATGGGCCAAGG[T/C]ACAATCCATGTCCTTTGAATTTGTACAGTAACTGGATACATTAGCAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link