mcm3ap

Ensembl ID:
ENSDARG00000021402
ZFIN ID:
ZDB-GENE-040715-1
Description:
MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein [Source:UniProtKB/TrE
Human Orthologue:
MCM3AP
Human Description:
minichromosome maintenance complex component 3 associated protein [Source:HGNC Symbol;Acc:6946]
Mouse Orthologue:
Mcm3ap
Mouse Description:
minichromosome maintenance deficient 3 (S. cerevisiae) associated protein Gene [Source:MGI Symbol;Ac

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8980 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13572 Nonsense Available for shipment Available now
sa17895 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008053 Essential Splice Site 718 2118 6 30
ENSDART00000056051 Essential Splice Site 718 1820 7 26
ENSDART00000142512 Essential Splice Site 718 2082 7 31

The following transcripts of ENSDARG00000021402 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 39516735)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACGCAACCAACTGAGTGTCTTTGAGGTSGTTCCAGATACTGAAAAGG[T/A]TTGTGATAATATGCAGTGTCTAATAATGSCTATGTTCACNTTTTTTYTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13572
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008053 Nonsense 722 2118 7 30
ENSDART00000056051 Nonsense 722 1820 8 26
ENSDART00000142512 Nonsense 722 2082 8 31

The following transcripts of ENSDARG00000021402 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 39517611)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACTTTTGAGTGGATTACATTATCACCTTCTGCTTAGGTGGATCATTA[T/A]GCTGCTAKCAAAGAGTATAGCAGGTCTTCAGCTGATCAGGAAGAACCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008053 Essential Splice Site 1492 2118 20 30
ENSDART00000056051 Essential Splice Site 1456 1820 21 26
ENSDART00000142512 Essential Splice Site 1456 2082 21 31

The following transcripts of ENSDARG00000021402 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 39525917)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGACCAATATTAGGGGACAGACTCATGAAGTTTACATTTCTGTAAAGG[T/C]RAGCTTATAGWGTAAATANTTTGAAMAAATTTGATTATTATTTACTYCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qj26oqvr