yipf2

Ensembl ID:
ENSDARG00000021399
ZFIN ID:
ZDB-GENE-040724-124
Description:
protein YIPF2 [Source:RefSeq peptide;Acc:NP_001003500]
Human Orthologue:
YIPF2
Human Description:
Yip1 domain family, member 2 [Source:HGNC Symbol;Acc:28476]
Mouse Orthologue:
Yipf2
Mouse Description:
Yip1 domain family, member 2 Gene [Source:MGI Symbol;Acc:MGI:1922016]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20064 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003133 Essential Splice Site 62 304 4 9
Genomic Location:
Chromosome 3 (position 34265012)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTAGTCACTCACTGGTTGTTTTTCCACATTGTGCAATATTCTCCACA[G/A]TTGCTTGGAGGGGAAAAGAAAACTGGTGGGTTTTGGACGTTTGAATACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rx1mbwrj