LOC569662

Ensembl ID:
ENSDARG00000021392
Human Orthologue:
CHRNB4
Human Description:
cholinergic receptor, nicotinic, beta 4 [Source:HGNC Symbol;Acc:1964]
Mouse Orthologue:
Chrnb4
Mouse Description:
cholinergic receptor, nicotinic, beta polypeptide 4 Gene [Source:MGI Symbol;Acc:MGI:87892]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42435 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42435
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039985 Nonsense 109 475 4 5
Genomic Location (Zv9):
Chromosome 14 (position 43040758)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 41140011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGTATGAAGGGATGAGGAAAGTTCGGCTTCCCTCTCAACATATATG[G/A]CTGCCTGACATCGTCCTGTACAACAAGTAAGACATTACTGTATATAGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lung cancer: A susceptibility locus for lung cancer maps to nicotinic acetylcholine receptor subunit genes on 15q25. (View Study)
  • Lung cancer: Familial aggregation of common sequence variants on 15q24-25.1 in lung cancer. (View Study)
  • Nicotine dependence: A variant associated with nicotine dependence, lung cancer and peripheral arterial disease. (View Study)
  • Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link