jag2

Ensembl ID:
ENSDARG00000021389
ZFIN ID:
ZDB-GENE-011128-3
Description:
protein jagged-2 isoform 1 [Source:RefSeq peptide;Acc:NP_571937]
Human Orthologue:
JAG2
Human Description:
jagged 2 [Source:HGNC Symbol;Acc:6189]
Mouse Orthologue:
Jag2
Mouse Description:
jagged 2 Gene [Source:MGI Symbol;Acc:MGI:1098270]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4891 Essential Splice Site Mutation detected in F1 DNA During 2014
hu3425 Nonsense Confirmed mutation in F2 line Unknown
sa13408 Essential Splice Site Available for shipment Available now
sa23675 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4892 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4893 Nonsense Mutation detected in F1 DNA During 2014
sa1720 Essential Splice Site Available for shipment Available now
sa10654 Nonsense Available for shipment Available now
sa10420 Essential Splice Site Available for shipment Available now
sa6629 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Essential Splice Site 23 1254 1 26
ENSDART00000049586 Essential Splice Site 23 1216 1 25
Genomic Location:
Chromosome 20 (position 21463572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGGAATTGGCTCCCAATMGCGTGCCTGCTGTTAACGATGTGGACGAAG[G/A]TGAGAGCTCTGATTGTTATTAGTGTTGCAGATCGATTTAATTGCCGTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3425
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Nonsense 30 1254 2 26
ENSDART00000049586 Nonsense 30 1216 2 25
Genomic Location:
Chromosome 20 (position 21464049)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCTTTCTGTTTTTCAATGTATTTTTAGGTGTCCCAGTCCTCTGGCTA[T/A]TTTGAGCTGCAGCTGATTGCTGTAGAAAATGTAAACGGTGAGTTGTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13408
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Essential Splice Site 130 1254 2 26
ENSDART00000049586 Essential Splice Site 130 1216 2 25
Genomic Location:
Chromosome 20 (position 21464351)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGAGCGACGTGGGAAAGATCATCATCCCKTTTCACTTCGCCTGGCCGG[T/G]GAGTCCTCGTCTTCTCYATGGGCTGTAATNAAAAAACGCGCCGCGGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Essential Splice Site 255 1254 5 26
ENSDART00000049586 Essential Splice Site 255 1216 5 25
Genomic Location:
Chromosome 20 (position 21502521)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCTGTAATCTGATTCACGGAGGCTGTGCGGTGCCTGGAGAATGCAAG[T/C]AAGTGTCTGAGCATCATTTCATGGTCGGTTGGCCCGGCTAATCTAGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Essential Splice Site 298 1254 6 26
ENSDART00000049586 Essential Splice Site 298 1216 6 25
Genomic Location:
Chromosome 20 (position 21510007)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCAATGCACTTGTGAGAAGAACTGGGGCGGCCTCCTCTGCGATAAAG[G/A]TAAGGGTCCTGAATGCAGCTGACACACTGATGCTGAAAATGTGACCTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Nonsense 437 1254 10 26
ENSDART00000049586 None None 1216 None 25
Genomic Location:
Chromosome 20 (position 21520019)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAAGCCTTGCGTAAATGCTCACTCTTGCAAAAACATGATTGGTGGATA[T/A]CACTGTGACTGCTTTCAAGGATGGGCCGGACAGAACTGTGACATCAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1720
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Essential Splice Site 468 1254 11 26
ENSDART00000049586 Essential Splice Site 430 1216 10 25
Genomic Location:
Chromosome 20 (position 21520422)
KASP Assay ID:
554-1666.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCTCAATGGCTGCCATGGACAGTGCCAGAATGGAGCTACTTGCAAGG[T/A]ATGTAGACTTTTAAGGTGCTGTATTGTCGCTTCAGCTAATTGTGCTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10654
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Nonsense 479 1254 12 26
ENSDART00000049586 Nonsense 441 1216 11 25
Genomic Location:
Chromosome 20 (position 21520536)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTTGTGTCWGTGCAGGAGCTGGKTCATGGAGGTTACCACTGTCAGTG[T/A]CCTGCGGGGTTTGTGGGCTTACACTGTGAAGTCTCAAGGAATAAATGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Essential Splice Site 828 1254 20 26
ENSDART00000049586 Essential Splice Site 790 1216 19 25
Genomic Location:
Chromosome 20 (position 21534728)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCGCTGTGAATGTGCTCCTGGATTTGCAGGACCCGACTGCCGTAWCAG[T/C]GAGTATCTCAAAGAGGAAAGAATGGSGACATATAGAAAGAGGGGTGTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024922 Essential Splice Site 1083 1254 25 26
ENSDART00000049586 Essential Splice Site 1045 1216 24 25
Genomic Location:
Chromosome 20 (position 21542060)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGTCATCGAGGTCAAAGTGGAGATGCCGGTCACGTCTCAGCCAGTGGG[T/C]GAGTAGAGCCAACTGGCCTCAAGGCTAAACCAGCMCTCATCCCCCGACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fjp1n794