phf21a

Ensembl ID:
ENSDARG00000021378
ZFIN ID:
ZDB-GENE-030131-6456
Description:
Phf21a protein [Source:UniProtKB/TrEMBL;Acc:Q08CP0]
Human Orthologue:
PHF21A
Human Description:
PHD finger protein 21A [Source:HGNC Symbol;Acc:24156]
Mouse Orthologue:
Phf21a
Mouse Description:
PHD finger protein 21A Gene [Source:MGI Symbol;Acc:MGI:2384756]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18275 Nonsense Available for shipment Available now
sa3290 Missense, Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa18275
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021577 Nonsense 279 796 8 17
ENSDART00000121435 Nonsense 279 539 8 16
ENSDART00000126499 Nonsense 280 745 6 14
ENSDART00000142439   None 168 None 7
ENSDART00000146882   None 87 None 2
Genomic Location (Zv9):
Chromosome 25 (position 7990909)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7603433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGCACCACGCAACTCGCAGGCATCGTCATCAGCCCTGCCCAGACACTT[C/T]AGATCAGCAATCTTAACTCAGACWTGAAGGTGAGAGTACTTATTTGGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3290
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021577 Missense 534 796 16 17
ENSDART00000121435 Nonsense 536 539 16 16
ENSDART00000126499 Missense 483 745 13 14
ENSDART00000142439   None 168 None 7
ENSDART00000146882   None 87 None 2
Genomic Location (Zv9):
Chromosome 25 (position 7985528)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7598052
KASP Assay ID:
554-2449.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTGTAGGAGCACATCACAATCATATTTGTTTTGTCCCTGTCCAAAAAG[C/T]AAAAGAAGAAGAGAAGCAGAAGCTAATGAAATGGAGTGCTGAACTAAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link