sh3pxd2b

Ensembl ID:
ENSDARG00000021377
ZFIN ID:
ZDB-GENE-060810-52
Description:
Im:7155315 protein [Source:UniProtKB/TrEMBL;Acc:Q6DC19]
Human Orthologue:
SH3PXD2B
Human Description:
SH3 and PX domains 2B [Source:HGNC Symbol;Acc:29242]
Mouse Orthologue:
Sh3pxd2b
Mouse Description:
SH3 and PX domains 2B Gene [Source:MGI Symbol;Acc:MGI:2442062]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24036 Essential Splice Site Available for shipment Available now
sa9265 Nonsense Mutation detected in F1 DNA During 2017
sa37381 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24036
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031308 Essential Splice Site 221 565 8 13
Genomic Location (Zv9):
Chromosome 21 (position 42369967)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 42773473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAAGCTCAAGATGATCCGGATGATTTCTCACTTCCAGCAGAAGAAGG[T/C]AAAGCCTCCTGAATAAAGCACCTGCAGCTAATATAGTATAATATTGGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031308 Nonsense 262 565 10 13
Genomic Location (Zv9):
Chromosome 21 (position 42363276)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 42780164
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTAGCAGTTTCTTGGRTGGAACRTTGTCRCCTTNACCCCCACAGGTAC[C/T]AAGGGAAAGAGGGCTGGGCCCCGGCATCTTACTTGAAGAAGGCTGACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031308 Nonsense 337 565 11 13
Genomic Location (Zv9):
Chromosome 21 (position 42362669)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 42780771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTTCTTCTCTTGCAGAAGTAGGGGCACGACAGAGGCCTCCACCACGC[C/T]GAGATCTTACAATAGTAAGGGTTATAATGCTTTTACAGTTGCATGTCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link