cab39l1

Ensembl ID:
ENSDARG00000021374
ZFIN ID:
ZDB-GENE-040426-2897
Description:
calcium binding protein 39, like 1 [Source:RefSeq peptide;Acc:NP_998666]
Human Orthologue:
CAB39
Human Description:
calcium binding protein 39 [Source:HGNC Symbol;Acc:20292]
Mouse Orthologue:
Cab39
Mouse Description:
calcium binding protein 39 Gene [Source:MGI Symbol;Acc:MGI:107438]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31993 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31993
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018347 Nonsense 165 343 5 9
Genomic Location (Zv9):
Chromosome 14 (position 32356186)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31145993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGGAGTGTCTGCGTCATGATCCTCTTGCCCGAATCGTTCTGTTCTCT[G/T]AGGATTTCTACTGCTTCTTCCGCTATGTGGAGATGTCTACCTTTGACATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link