mc3r

Ensembl ID:
ENSDARG00000021369
ZFIN ID:
ZDB-GENE-030502-3
Description:
melanocortin receptor 3 [Source:RefSeq peptide;Acc:NP_851303]
Human Orthologue:
MC3R
Human Description:
melanocortin 3 receptor [Source:HGNC Symbol;Acc:6931]
Mouse Orthologue:
Mc3r
Mouse Description:
melanocortin 3 receptor Gene [Source:MGI Symbol;Acc:MGI:96929]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa398 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa398
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017440 Nonsense 13 327 1 1
Genomic Location:
Chromosome 8 (position 29503323)
KASP Assay ID:
554-0261.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCACCAATCCCGATGAACGACTCACATCTGCAGTTTCTTAAAGGACAG[A/T]AATCTGTAAACAGCACTTCTTTGCCTCCTAATGGCAGTTTGGCTGATTCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m5yh1qon