gria1a

Ensembl ID:
ENSDARG00000021352
ZFIN ID:
ZDB-GENE-020125-1
Description:
glutamate receptor, ionotropic, AMPA 1a [Source:RefSeq peptide;Acc:NP_991161]
Human Orthologue:
GRIA1
Human Description:
glutamate receptor, ionotropic, AMPA 1 [Source:HGNC Symbol;Acc:4571]
Mouse Orthologue:
Gria1
Mouse Description:
glutamate receptor, ionotropic, AMPA1 (alpha 1) Gene [Source:MGI Symbol;Acc:MGI:95808]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22517 Nonsense Available for shipment Available now
sa17471 Nonsense Available for shipment Available now
sa22516 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021437 Nonsense 38 914 2 16
Genomic Location:
Chromosome 14 (position 35364601)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTTCCTTTCTCCCCAGGAGGGTTATTCCCAACCGAATCACACGAATA[T/A]GAAGTGTTTCGTTTTGCGCTCTCGCATCACCAGGATATCCCTAAACTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021437 Nonsense 595 914 11 16
Genomic Location:
Chromosome 14 (position 35268964)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCRTCCTCRTCATCCGCCCAACCGGGTCAGAACCAGCAAAACCAGAAY[C/T]AGCAGAGTCAGGAGCAAACCAACGAGTTYGGCATCTTCAACAGTCTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22516
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021437 Nonsense 619 914 11 16
Genomic Location:
Chromosome 14 (position 35268892)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAGTTTGGCATCTTCAACAGTCTCTGGTTCTCACTGGGAGCTTTCATG[C/T]AGCAGGGCTGTGACATTTCCCCCAGGTGAGATGCCAGTTTGTGTTTTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g5gdxkn1