gria1a

Ensembl ID:
ENSDARG00000021352
ZFIN ID:
ZDB-GENE-020125-1
Description:
glutamate receptor, ionotropic, AMPA 1a [Source:RefSeq peptide;Acc:NP_991161]
Human Orthologue:
GRIA1
Human Description:
glutamate receptor, ionotropic, AMPA 1 [Source:HGNC Symbol;Acc:4571]
Mouse Orthologue:
Gria1
Mouse Description:
glutamate receptor, ionotropic, AMPA1 (alpha 1) Gene [Source:MGI Symbol;Acc:MGI:95808]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22517 Nonsense Available for shipment Available now
sa30982 Nonsense Mutation detected in F1 DNA During 2016
sa42418 Nonsense Mutation detected in F1 DNA During 2016
sa17471 Nonsense Available for shipment Available now
sa22516 Nonsense Available for shipment Available now
sa42417 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021437 Nonsense 38 914 2 16
Genomic Location (Zv9):
Chromosome 14 (position 35364601)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33935813
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTTCCTTTCTCCCCAGGAGGGTTATTCCCAACCGAATCACACGAATA[T/A]GAAGTGTTTCGTTTTGCGCTCTCGCATCACCAGGATATCCCTAAACTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30982
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021437 Nonsense 268 914 6 16
Genomic Location (Zv9):
Chromosome 14 (position 35284271)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33855483
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTCAGCTGGTGAATTACGCAGATCCTAATGTCAGCAGGACAGTGCAG[C/T]AGTGGATGGAGTTTGACAATAAAGATGCCAAAGTTCCCAAGCGAAGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021437 Nonsense 563 914 11 16
Genomic Location (Zv9):
Chromosome 14 (position 35269059)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33840271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCGTGAGCGTGGTACTTTTTCTGGTCAGCCGCTTCAGTCCCTATGAGT[G/A]GCATGCAGATGACTGTGAGGACGGAGCAGAGGAGAACCCAAACCAGCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021437 Nonsense 595 914 11 16
Genomic Location (Zv9):
Chromosome 14 (position 35268964)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33840176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCRTCCTCRTCATCCGCCCAACCGGGTCAGAACCAGCAAAACCAGAAY[C/T]AGCAGAGTCAGGAGCAAACCAACGAGTTYGGCATCTTCAACAGTCTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021437 Nonsense 619 914 11 16
Genomic Location (Zv9):
Chromosome 14 (position 35268892)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33840104
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAGTTTGGCATCTTCAACAGTCTCTGGTTCTCACTGGGAGCTTTCATG[C/T]AGCAGGGCTGTGACATTTCCCCCAGGTGAGATGCCAGTTTGTGTTTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021437 Nonsense 784 914 14 16
Genomic Location (Zv9):
Chromosome 14 (position 35235048)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33806260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATATTATGTCGTTATCATTTCAAGAAACCCAGTAAACCTGGCAGTGT[T/A]AAAACTGAATGAACAAGGCCTGTTGGACAAATTGAAAAACAAATGGTGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link