pdhb

Ensembl ID:
ENSDARG00000021346
ZFIN ID:
ZDB-GENE-040426-2173
Description:
pyruvate dehydrogenase E1 component subunit beta, mitochondrial [Source:RefSeq peptide;Acc:NP_99831
Human Orthologue:
PDHB
Human Description:
pyruvate dehydrogenase (lipoamide) beta [Source:HGNC Symbol;Acc:8808]
Mouse Orthologue:
Pdhb
Mouse Description:
pyruvate dehydrogenase (lipoamide) beta Gene [Source:MGI Symbol;Acc:MGI:1915513]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3153 Nonsense F2 line generated During 2017
sa12405 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3153
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006513 Nonsense 67 359 3 10
ENSDART00000132641 Nonsense 67 203 3 6
Genomic Location (Zv9):
Chromosome 22 (position 10315907)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10176075
KASP Assay ID:
554-2546.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACGGGTCTTCCTGCTCGGAGAGGAAGTYGCACAGTATGACGGCGCATA[C/A]AAGGTCAGATAGACACATTTATTCAAACANTTTTTCTGATTAATGACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12405
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006513 Essential Splice Site 234 359 8 10
ENSDART00000132641   None 203 None 6
Genomic Location (Zv9):
Chromosome 22 (position 10320601)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10180769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTGAACTGAATCGTTGTGTGTGNNTATATTAATATTGGTGTTCTGATGT[A/T]GGAAATCACATCACAYTGGTGTCTCACTCCCGAATGGTCGGTCTGTGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link