nsun4

Ensembl ID:
ENSDARG00000021324
ZFIN ID:
ZDB-GENE-041212-77
Description:
NOL1/NOP2/Sun domain family, member 4 [Source:RefSeq peptide;Acc:NP_001008649]
Human Orthologue:
NSUN4
Human Description:
NOP2/Sun domain family, member 4 [Source:HGNC Symbol;Acc:31802]
Mouse Orthologue:
Nsun4
Mouse Description:
NOL1/NOP2/Sun domain family, member 4 Gene [Source:MGI Symbol;Acc:MGI:1919431]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19685 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19685
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007405 Nonsense 37 327 2 6
ENSDART00000136018 Nonsense 103 393 2 6
Genomic Location (Zv9):
Chromosome 2 (position 9949808)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10363091
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACAGATTTAGAAGCTGAAGGGTGTAGAGACTTCATAACTATTGACTG[T/A]TCTAGAAATGAGGTCCATAAGTCCTCACAGGACCCCACAACCCCTCACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link