capg

Ensembl ID:
ENSDARG00000021318
ZFIN IDs:
ZDB-GENE-030131-8541, ZDB-GENE-030131-8541
Description:
capping protein (actin filament), gelsolin-like [Source:RefSeq peptide;Acc:NP_001001594]
Human Orthologue:
CAPG
Human Description:
capping protein (actin filament), gelsolin-like [Source:HGNC Symbol;Acc:1474]
Mouse Orthologue:
Capg
Mouse Description:
capping protein (actin filament), gelsolin-like Gene [Source:MGI Symbol;Acc:MGI:1098259]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13484 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010848 Nonsense 128 345 4 9
ENSDART00000111677 Nonsense 157 374 5 10
Genomic Location:
Chromosome 12 (position 23954359)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTCTGTTTGTGCAGGAGGGAGGAGTGGAGTCTGGCTTCAGAAGAGCG[C/T]AGTCTGGACCTGGACCTGTTCAGAGGTTATACCAAATCAAAGGGAAACGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x11awqwf