mybpc2b

Ensembl ID:
ENSDARG00000021265
ZFIN ID:
ZDB-GENE-050320-80
Description:
myosin-binding protein C, fast-type [Source:RefSeq peptide;Acc:NP_001013529]
Human Orthologue:
MYBPC2
Human Description:
myosin binding protein C, fast type [Source:HGNC Symbol;Acc:7550]
Mouse Orthologue:
Mybpc2
Mouse Description:
myosin binding protein C, fast-type Gene [Source:MGI Symbol;Acc:MGI:1336170]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10810 Nonsense Available for shipment Available now
sa19351 Nonsense Mutation detected in F1 DNA During 2014
sa24551 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10810
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105672 Nonsense 259 1111 10 29
ENSDART00000143184 Nonsense 240 1092 7 26
ENSDART00000105672 Nonsense 259 1111 10 29
ENSDART00000143184 Nonsense 240 1092 7 26
Genomic Location:
Chromosome 24 (position 39813470)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGGAGGTGGCAGATCCTAATGCCGAGGTCAAATGGCTGAGGAACGGA[C/T]AAGAGATCAAACCCTCTGCCAAGTAATAATGCAAATAATRTRTTCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105672 Nonsense 259 1111 10 29
ENSDART00000143184 Nonsense 240 1092 7 26
ENSDART00000105672 Nonsense 259 1111 10 29
ENSDART00000143184 Nonsense 240 1092 7 26
Genomic Location:
Chromosome 24 (position 39813470)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGGAGGTGGCAGATCCTAATGCCGAGGTCAAATGGCTGAGGAACGGA[C/T]AAGAGATCAAACCCTCTGCCAAGTAATAATGCAAATAATGTGTTCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105672 Nonsense 638 1111 20 29
ENSDART00000143184 Nonsense 619 1092 17 26
Genomic Location:
Chromosome 24 (position 39824971)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATGTGAATGAGAAAGTTGAATCAGTTCTGCTTGTGTTTTCCAGGCTA[T/A]CTGATGGAGAGGAAGAAGAAAGGATCATCTAGATGGACGAAACTGAACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sj9uo187