eif3d

Ensembl ID:
ENSDARG00000021257
ZFIN ID:
ZDB-GENE-030131-8442
Description:
Eukaryotic translation initiation factor 3 subunit D [Source:UniProtKB/Swiss-Prot;Acc:Q6TH15]
Human Orthologue:
EIF3D
Human Description:
eukaryotic translation initiation factor 3, subunit D [Source:HGNC Symbol;Acc:3278]
Mouse Orthologue:
Eif3d
Mouse Description:
eukaryotic translation initiation factor 3, subunit D Gene [Source:MGI Symbol;Acc:MGI:1933181]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15631 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15631
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011052 Nonsense 329 552 10 16
ENSDART00000132298 Nonsense 327 550 11 17

The following transcripts of ENSDARG00000021257 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 29800117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCGAAACCTGGCCATGGAGGCYACTTACATCAACCACAACTTCAGYCAG[C/T]AGTGTCTCCGCATGGTAYGCTTGAGGTTTTCCCCAGTATACTGATCATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r9ju8q05