si:ch211-223a10.2

Ensembl ID:
ENSDARG00000021255
ZFIN ID:
ZDB-GENE-090313-87
Human Orthologue:
ARHGAP22
Human Description:
Rho GTPase activating protein 22 [Source:HGNC Symbol;Acc:30320]
Mouse Orthologue:
Arhgap22
Mouse Description:
Rho GTPase activating protein 22 Gene [Source:MGI Symbol;Acc:MGI:2443418]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42227 Nonsense Mutation detected in F1 DNA During 2017
sa42228 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22334 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014922 Nonsense 57 698 2 10
ENSDART00000142245 Nonsense 42 317 1 7
Genomic Location (Zv9):
Chromosome 13 (position 31332061)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30978009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGTGAAGGCCGGCTGGCTGAAGAAACAGCGCAGCATCATGAAGAACTG[G/A]CAACTGCGCTGGTTTGTGCTCCGAACTGACCACCTCTACTTCTACAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014922 Essential Splice Site 153 698 4 10
ENSDART00000142245 Essential Splice Site 138 317 3 7
Genomic Location (Zv9):
Chromosome 13 (position 31352253)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30998201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATTGGGTCAAAGCCATCAGACGTGTCATCTGGGCTCCCTTTGGAGGAG[G/A]TAACTCATATTTATGGACCACACAAGCACAGAGACACAGGCAAAAATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22334
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014922 Nonsense 697 698 10 10
ENSDART00000142245   None 317 None 7
Genomic Location (Zv9):
Chromosome 13 (position 31363360)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31009308
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGTTCTTCTCCACTCTGGGGGATCTTACACTGGGAACAAGAACAAGC[A/T]AAATTTGACCGGCAGCCATGCTTATTTAACTCGGAGAGACTTCTGTGTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link