cct6a

Ensembl ID:
ENSDARG00000021252
ZFIN ID:
ZDB-GENE-011018-2
Description:
T-complex protein 1 subunit zeta [Source:RefSeq peptide;Acc:NP_958447]
Human Orthologues:
CCT6A, CCT6B
Human Descriptions:
chaperonin containing TCP1, subunit 6A (zeta 1) [Source:HGNC Symbol;Acc:1620]
chaperonin containing TCP1, subunit 6B (zeta 2) [Source:HGNC Symbol;Acc:1621]
Mouse Orthologues:
Cct6a, Cct6b
Mouse Descriptions:
chaperonin containing Tcp1, subunit 6a (zeta) Gene [Source:MGI Symbol;Acc:MGI:107943]
chaperonin containing Tcp1, subunit 6b (zeta) Gene [Source:MGI Symbol;Acc:MGI:1329013]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9774 Essential Splice Site Available for shipment Available now
sa16648 Nonsense Available for shipment Available now
sa10117 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9774
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009484 Essential Splice Site 205 531 6 15
ENSDART00000137630 Essential Splice Site 205 531 6 15
ENSDART00000141067 Essential Splice Site 160 242 5 7
Genomic Location:
Chromosome 21 (position 40520579)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGGTGGAGATTATGGAGAKKAAACACAAAACCGACAGTGATACTCAG[T/A]AAGACTCATAGCATTGTGTGCGGTCTCATGTCRATGTTAGACAACATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009484 Nonsense 237 531 7 15
ENSDART00000137630 Nonsense 237 531 7 15
ENSDART00000141067 Nonsense 192 242 6 7
Genomic Location:
Chromosome 21 (position 40517909)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGAAGAAGAGAAYAGAAGAKGCTTTCATTCTCACSTGCAACGTTTCCT[T/A]GGAATACGAGAAAACGTGAGCTTTATTCATTGYAGATTAYTGTGTGTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10117
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009484 Essential Splice Site 323 531 9 15
ENSDART00000137630 Essential Splice Site 323 531 9 15
ENSDART00000141067 None None 242 None 7
Genomic Location:
Chromosome 21 (position 40516351)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGGGCATTGTGGCTCTGCGCCGTGCAAAGAGACGGAATATGGAAAGG[T/C]AAAGGTGGCACTGCTGCCAATTTCTGATTTACCTGCTTGAATCCTTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1f8pvu6c