apaf1

Ensembl ID:
ENSDARG00000021239
ZFIN ID:
ZDB-GENE-000616-4
Description:
Apoptotic protease-activating factor 1 [Source:UniProtKB/Swiss-Prot;Acc:Q9I9H8]
Human Orthologue:
APAF1
Human Description:
apoptotic peptidase activating factor 1 [Source:HGNC Symbol;Acc:576]
Mouse Orthologue:
Apaf1
Mouse Description:
apoptotic peptidase activating factor 1 Gene [Source:MGI Symbol;Acc:MGI:1306796]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16025 Nonsense Available for shipment Available now
sa14399 Essential Splice Site Available for shipment Available now
sa10293 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16025
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019165 Nonsense 129 1261 4 27
ENSDART00000113507 Nonsense 129 464 4 11
ENSDART00000127261 Nonsense 130 1264 4 27

The following transcripts of ENSDARG00000021239 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 16914489)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17857329
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGATTCTGAGTGTAGGAGGTGTTCCTCAGAGACCTGTGGTGTTCGTGAGT[C/T]GACCTCCACTGCTCAATCTGATCCGGGAGATGCTGTACCRGCTGCGGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14399
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019165 Essential Splice Site 176 1261 5 27
ENSDART00000113507 Essential Splice Site 176 464 5 11
ENSDART00000127261 Essential Splice Site 177 1264 5 27

The following transcripts of ENSDARG00000021239 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 16915194)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17858034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATGCACAGAGTACAGTGTACGTGAATGTATTTTTGTCTCTRTTCTCC[A/T]GAGTGTTTTCCTGATGGTGTTCACTGGCTGTCTGTGGGTCAGTGTGAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10293
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019165 Nonsense 886 1261 19 27
ENSDART00000113507   None 464 None 11
ENSDART00000127261 Nonsense 887 1264 19 27

The following transcripts of ENSDARG00000021239 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 16923329)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17866169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTCGAAAGCAGTAAGAAGAAAGCCGAATGCAGTGGTCATCTGAGCTG[G/A]GTTCACTGTGTGCAGTTTTCACCCGACGGCTCACTCCTGCTGTCCTCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link