prkci

Ensembl ID:
ENSDARG00000021225
ZFIN ID:
ZDB-GENE-011105-1
Description:
Protein kinase C iota type [Source:UniProtKB/Swiss-Prot;Acc:Q90XF2]
Human Orthologue:
PRKCI
Human Description:
protein kinase C, iota [Source:HGNC Symbol;Acc:9404]
Mouse Orthologue:
Prkci
Mouse Description:
protein kinase C, iota Gene [Source:MGI Symbol;Acc:MGI:99260]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14108 Nonsense Available for shipment Available now
sa17535 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015723 Nonsense 37 588 2 18

The following transcripts of ENSDARG00000021225 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37114342)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37411052
KASP Assay ID:
2259-2347.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTTTTTTTNNNTGTTTTAGGGACATCATGATCACACATTTTGAGCCTT[C/A]GATCTCCTATGAGGGACTCTGCAATGAGGTGCGKGATATGTGCTCCATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17535
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015723 Nonsense 167 588 6 18

The following transcripts of ENSDARG00000021225 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37108338)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37405048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGATCGTATCTGGGGTCTGGGCAGGCAGGGATACAAGTGTATCAACTG[T/A]AAGCTTCTGGTGCATAAGAAATGCCATAAGCTGGTCACAGTAGAATGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link