JAKMIP3

Ensembl ID:
ENSDARG00000021213
Description:
Janus kinase and microtubule interacting protein 3 [Source:HGNC Symbol;Acc:23523]
Human Orthologue:
JAKMIP3
Human Description:
Janus kinase and microtubule interacting protein 3 [Source:HGNC Symbol;Acc:23523]
Mouse Orthologue:
Jakmip3
Mouse Description:
janus kinase and microtubule interacting protein 3 Gene [Source:MGI Symbol;Acc:MGI:1921254]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42094 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35370 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24920 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38905 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31894 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054593 Essential Splice Site 212 628 6 19
Genomic Location (Zv9):
Chromosome 12 (position 43764061)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 41155569
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTACATATTTGTGATTTTGACATACTTTTGTTTTTAATGGTGTTCTTC[A/T]GGAGCGAGATATGCTGCTGAGATATAGGAGACAGGACAGCCTGCGCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054593 Essential Splice Site 275 628 8 19
Genomic Location (Zv9):
Chromosome 12 (position 43767177)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 41152856
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTGTGTAAGCTGTGCCTGTAAACGCGTTGTGTGGGTGTGTGTGTGT[A/G]GGGCATGCTGAAGGAGGAGACAGAGCTGCGTTTCCGTCAGCTGACGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054593 Essential Splice Site 317 628 8 19
Genomic Location (Zv9):
Chromosome 12 (position 43767308)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 41152725
KASP Assay ID:
554-7803.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGCAGGAGCAGGTGGGAGGAACCTTTGATGCAGAGAAGGAACTGAAG[G/A]TAAATCATTTAAACACATCAAACATTTACAGTCGCCTAACAACAACATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38905
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054593 Essential Splice Site 472 628 14 19
Genomic Location (Zv9):
Chromosome 12 (position 43773308)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 41146725
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAAGTGGTGGTTATTCATGCCAGGACCGTACTAACATTAGCAGAGAAG[G/A]TATGAGACGTTTCATTGTAAGTTATTTTATATTGTTCGCTTGCTGTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054593 Nonsense 570 628 17 19
Genomic Location (Zv9):
Chromosome 12 (position 43777893)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 41142139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGCTGAGAGGAGCTGTGGATCAGTGGAAGCGGCAGGTCTTGAGTGAAT[T/A]ACGAGAGAGAGACGCGCAGATCCTGAGAGAGAGAATGGAGCTGCTGCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link