NP_001013585.2

Ensembl ID:
ENSDARG00000021209
Description:
potassium channel tetramerisation domain containing 9 [Source:RefSeq peptide;Acc:NP_001013585]
Human Orthologue:
KCTD9
Human Description:
potassium channel tetramerisation domain containing 9 [Source:HGNC Symbol;Acc:22401]
Mouse Orthologue:
Kctd9
Mouse Description:
potassium channel tetramerisation domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:2145579]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa730 Essential Splice Site Available for shipment Available now
sa9615 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa730
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043389   165 178 6 7
ENSDART00000098261 Essential Splice Site 164 178 6 8
ENSDART00000098263   167 391 6 12
ENSDART00000145397   165 389 6 12
ENSDART00000043389   165 178 6 7
ENSDART00000098261 Essential Splice Site 164 178 None 8
ENSDART00000098263   167 391 6 12
ENSDART00000145397   165 389 6 12
Genomic Location (Zv9):
Chromosome 8 (position 53872134)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51607493
KASP Assay ID:
554-0637.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTCAATTACCTGAGACATGGTCAGATCATCATCAATGATGGAATAAAC[T/C]TACTCGGTGAGTCAGCCKGAATGCTACMTGAAGCGTTTTTAGGTGAYTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043389   165 178 6 7
ENSDART00000098261 Essential Splice Site 164 178 6 8
ENSDART00000098263   167 391 6 12
ENSDART00000145397   165 389 6 12
ENSDART00000043389   165 178 6 7
ENSDART00000098261 Essential Splice Site 164 178 None 8
ENSDART00000098263   167 391 6 12
ENSDART00000145397   165 389 6 12
Genomic Location (Zv9):
Chromosome 8 (position 53872134)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51607493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TMCTCAATTACCTGAGACATGGTCAGATCATCATCAATGATGGAATAAAC[T/C]TACTCGGTGAGTCAGCCKGAATGCTACMTGAAGCGTTTTTAGGTGAYTGY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link