chmp6b

Ensembl ID:
ENSDARG00000021202
ZFIN ID:
ZDB-GENE-040924-2
Description:
Charged multivesicular body protein 6 [Source:UniProtKB/Swiss-Prot;Acc:Q503V0]
Human Orthologue:
CHMP6
Human Description:
chromatin modifying protein 6 [Source:HGNC Symbol;Acc:25675]
Mouse Orthologue:
Chmp6
Mouse Description:
chromatin modifying protein 6 Gene [Source:MGI Symbol;Acc:MGI:3583942]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42076 Nonsense Mutation detected in F1 DNA During 2016
sa42075 Nonsense Mutation detected in F1 DNA During 2016
sa22149 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022767 Nonsense 33 188 2 7
Genomic Location (Zv9):
Chromosome 12 (position 35734236)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35487400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTGTGTGAGCAGCAACTGAAACAGCAGAGAGATAAACTGAAGCAGTA[T/A]CAGAAGAGGATCACGCTTCAGATGGACAAGGAGCGACAACTGGCCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42075
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022767 Nonsense 89 188 4 7
Genomic Location (Zv9):
Chromosome 12 (position 35733885)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35487751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAAGACTGCAGCATTTATTGTATTTCTTTATTTTGGTTTTTACAGGTA[C/T]AAGATATTGAATTTGCACAAATAGAGATGAAAGTTATTGAAGGATTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022767 Essential Splice Site 138 188 5 7
Genomic Location (Zv9):
Chromosome 12 (position 35733646)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35487990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGGAGAAAATCATGGATGAAACACATGATGCCATTGAGTATCAGAAG[G/A]TACATTTTACTTCTCACAATGTGAAAGGACCCCTTATATACACTGAGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link