chmp6b

Ensembl ID:
ENSDARG00000021202
ZFIN ID:
ZDB-GENE-040924-2
Description:
Charged multivesicular body protein 6 [Source:UniProtKB/Swiss-Prot;Acc:Q503V0]
Human Orthologue:
CHMP6
Human Description:
chromatin modifying protein 6 [Source:HGNC Symbol;Acc:25675]
Mouse Orthologue:
Chmp6
Mouse Description:
chromatin modifying protein 6 Gene [Source:MGI Symbol;Acc:MGI:3583942]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22149 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022767 Essential Splice Site 138 188 5 7
Genomic Location:
Chromosome 12 (position 35733646)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGGAGAAAATCATGGATGAAACACATGATGCCATTGAGTATCAGAAG[G/A]TACATTTTACTTCTCACAATGTGAAAGGACCCCTTATATACACTGAGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yki2l0hw