si:dkey-202g15.6

Ensembl ID:
ENSDARG00000021193
ZFIN IDs:
ZDB-GENE-030131-418, ZDB-GENE-070705-358
Human Orthologue:
CORO1C
Human Description:
coronin, actin binding protein, 1C [Source:HGNC Symbol;Acc:2254]
Mouse Orthologue:
Coro1c
Mouse Description:
coronin, actin binding protein 1C Gene [Source:MGI Symbol;Acc:MGI:1345964]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25301 Nonsense Mutation detected in F1 DNA During 2017
sa31455 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25301
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039796 Nonsense 352 482 8 10
ENSDART00000140640   None 66 None 2
ENSDART00000141446 Nonsense 344 474 9 11
ENSDART00000147814   None 197 None 7
Genomic Location (Zv9):
Chromosome 5 (position 33525706)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31287938
KASP Assay ID:
554-7896.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATGTCTGTTGTCTCTCACAGATTTTATAAACTCCATGAAAGAAAGTG[T/A]GAGCCAATCATCATGACCGTCCCTAGAAAGGTACTTTCCACAGAATATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31455
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039796 Essential Splice Site 362 482 8 10
ENSDART00000140640   None 66 None 2
ENSDART00000141446 Essential Splice Site 354 474 9 11
ENSDART00000147814   None 197 None 7
Genomic Location (Zv9):
Chromosome 5 (position 33525674)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31287906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCATGAAAGAAAGTGTGAGCCAATCATCATGACCGTCCCTAGAAAGG[T/A]ACTTTCCACAGAATATTCTCTATTATTTTTCCATCAGTCTGAATAATAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link