rbfox1l

Ensembl ID:
ENSDARG00000021184
ZFIN ID:
ZDB-GENE-040923-2
Description:
Fox-1 homolog-like protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZT82]
Human Orthologues:
RBFOX1, RBFOX2, RBFOX3
Human Descriptions:
RNA binding protein, fox-1 homolog (C. elegans) 1 [Source:HGNC Symbol;Acc:18222]
RNA binding protein, fox-1 homolog (C. elegans) 2 [Source:HGNC Symbol;Acc:9906]
RNA binding protein, fox-1 homolog (C. elegans) 3 [Source:HGNC Symbol;Acc:27097]
Mouse Orthologues:
D11Bwg0517e, Rbfox1, Rbfox2
Mouse Descriptions:
DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed Gene [Source:MGI Symbol;Acc:MGI:10636
RNA binding protein, fox-1 homolog (C. elegans) 1 Gene [Source:MGI Symbol;Acc:MGI:1926224]
RNA binding protein, fox-1 homolog (C. elegans) 2 Gene [Source:MGI Symbol;Acc:MGI:1933973]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12116 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12116
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027364 Nonsense 55 382 2 12

The following transcripts of ENSDARG00000021184 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 34134784)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAATGGTGATCCTTCACTTCCCCAGGTTTATGCCCCACCCCCTTCATA[T/A]CCTCCACCTGGACAAGCCCCGCCCACACCTGCTGCCCGACTGCCACCCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
  • Refractive error: Meta-analysis of genome-wide association studies in five cohorts reveals common variants in RBFOX1, a regulator of tissue-specific splicing, associated with refractive error. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qsvemzuu