cept1

Ensembl ID:
ENSDARG00000021177
ZFIN ID:
ZDB-GENE-071004-33
Description:
choline/ethanolaminephosphotransferase 1 [Source:RefSeq peptide;Acc:NP_001103187]
Human Orthologue:
CEPT1
Human Description:
choline/ethanolamine phosphotransferase 1 [Source:HGNC Symbol;Acc:24289]
Mouse Orthologue:
Cept1
Mouse Description:
choline/ethanolaminephosphotransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2139793]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13460 Nonsense Available for shipment Available now
sa15095 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035514 Nonsense 117 415 4 10
ENSDART00000081593 Nonsense 117 415 2 8
ENSDART00000137522 None None 180 None 5
Genomic Location:
Chromosome 22 (position 857281)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGAAYTTATGATAAATTAATGTAATTGAGTGTTTTAGGCTCCRCTGTG[G/A]GCGTAWCTCCTGTGYGCGGTGGGTTTGTTTGTCTATCAGTCGCTGGAYGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15095
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035514 Nonsense 201 415 5 10
ENSDART00000081593 Nonsense 201 415 3 8
ENSDART00000137522 Nonsense 33 180 1 5
Genomic Location:
Chromosome 22 (position 856599)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGTTTCGCCGGCATGTTTATGTTTTATTGYGCACACTGGCAGACCTA[C/A]GTCTCCGGTACGCTGCGCTTCGGCATGTGAGTATAAAAAAYGAAYACART
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ieg0m9ji