thrb

Ensembl ID:
ENSDARG00000021163
ZFIN ID:
ZDB-GENE-990415-268
Description:
Thyroid hormone receptor beta [Source:UniProtKB/Swiss-Prot;Acc:Q9PVE4]
Human Orthologue:
THRB
Human Description:
thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian) [
Mouse Orthologue:
Thrb
Mouse Description:
thyroid hormone receptor beta Gene [Source:MGI Symbol;Acc:MGI:98743]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa749 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa749
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017869 None None 395 None 13
ENSDART00000019247 Essential Splice Site 228 470 7 10
ENSDART00000104469 None None 379 None 13

The following transcripts of ENSDARG00000021163 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 19509787)
KASP Assay ID:
554-0656.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTTTCCTCTTTTCCTTCTTAATAACTGGCATCAACTTTTTTTTCATT[G/C]CTGTCTTGCTGTAACTCTGGCCTTTGTGCTAGAACAAAAAGGAATGAGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5fuwnnx5