ptpreb

Ensembl ID:
ENSDARG00000021151
ZFIN ID:
ZDB-GENE-060503-263
Description:
protein tyrosine phosphatase, receptor type, E, b [Source:RefSeq peptide;Acc:NP_001038642]
Human Orthologue:
PTPRE
Human Description:
protein tyrosine phosphatase, receptor type, E [Source:HGNC Symbol;Acc:9669]
Mouse Orthologue:
Ptpre
Mouse Description:
protein tyrosine phosphatase, receptor type, E Gene [Source:MGI Symbol;Acc:MGI:97813]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31012 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36441 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009276 Essential Splice Site 372 686 11 19
ENSDART00000123027   None 89 None 6
ENSDART00000143444 Essential Splice Site 363 677 13 21
Genomic Location (Zv9):
Chromosome 17 (position 29398323)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29322250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGTGTCCAGAATCAGAAAGCAGCGCTGTCAGCTCATTCAGACAGATG[T/G]AAATGACTTTCCGCAGTCCCACTGTTGTATTTGACTCATCATTTCAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36441
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009276 Nonsense 472 686 14 19
ENSDART00000123027   None 89 None 6
ENSDART00000143444 Nonsense 463 677 16 21
Genomic Location (Zv9):
Chromosome 17 (position 29399774)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29323701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAACAGGGTAATATTATCAATGAAGAGAGGCCAAGAATTCACAGACTA[C/A]ATTAATGCATCTTTCATAGATGTAAGTATTCTTCACAAATATTTGTATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link