cbr1l

Ensembl ID:
ENSDARG00000021149
ZFIN ID:
ZDB-GENE-030131-9642
Description:
hypothetical protein LOC792137 [Source:RefSeq peptide;Acc:NP_001103752]
Human Orthologues:
CBR1, CBR3
Human Descriptions:
carbonyl reductase 1 [Source:HGNC Symbol;Acc:1548]
carbonyl reductase 3 [Source:HGNC Symbol;Acc:1549]
Mouse Orthologues:
Cbr1, Cbr3
Mouse Descriptions:
carbonyl reductase 1 Gene [Source:MGI Symbol;Acc:MGI:88284]
carbonyl reductase 3 Gene [Source:MGI Symbol;Acc:MGI:1309992]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15848 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15848
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010282 Essential Splice Site 199 277 4 4
Genomic Location:
Chromosome 21 (position 20521038)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGGCAGATAAGGAATTTGTCTTCACCACATTTGTTGTGTTTGTTTTT[A/C]GATTGGTGTGACTGTGCTWTCAAGAATCCAGGCACGAGTTCTTAATGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a7nzb84o