rtn1b

Ensembl ID:
ENSDARG00000021143
ZFIN ID:
ZDB-GENE-030710-3
Description:
reticulon 1b [Source:RefSeq peptide;Acc:NP_001025119]
Human Orthologue:
RTN1
Human Description:
reticulon 1 [Source:HGNC Symbol;Acc:10467]
Mouse Orthologue:
Rtn1
Mouse Description:
reticulon 1 Gene [Source:MGI Symbol;Acc:MGI:1933947]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43416 Nonsense Mutation detected in F1 DNA During 2017
sa37007 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027758   None 212 None 7
ENSDART00000060203 Nonsense 349 767 3 9
ENSDART00000079079   None 262 None 7
ENSDART00000128451 Nonsense 89 364 2 3
Genomic Location (Zv9):
Chromosome 20 (position 20730970)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20759137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGAACTCCATCCCAGACAGCACTCAAGCTTCAACAATCCCACCGGCT[C/T]AACCTGCCTCAAAGAAAGACAGTTCCCCAGTAGAAAATATGTCTGCCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027758   None 212 None 7
ENSDART00000060203 Nonsense 562 767 3 9
ENSDART00000079079   None 262 None 7
ENSDART00000128451 Nonsense 302 364 2 3
Genomic Location (Zv9):
Chromosome 20 (position 20731610)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20759777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGTGCACAAGAAAGAAAGGAGACGGTCCAGTCAAGCCCGCAGGGGCT[C/A]AGAGAAAACATCTGCTCCACCAGCTGTCTTCCAGGGTTTCAGCAGGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link