pabpc1b

Ensembl ID:
ENSDARG00000021140
ZFIN ID:
ZDB-GENE-050308-1
Description:
poly A binding protein, cytoplasmic 1 b [Source:RefSeq peptide;Acc:NP_957176]
Human Orthologues:
PABPC1, PABPC3
Human Descriptions:
poly(A) binding protein, cytoplasmic 1 [Source:HGNC Symbol;Acc:8554]
poly(A) binding protein, cytoplasmic 3 [Source:HGNC Symbol;Acc:8556]
Mouse Orthologues:
Pabpc1, Pabpc2, Pabpc6
Mouse Descriptions:
poly(A) binding protein, cytoplasmic 1 Gene [Source:MGI Symbol;Acc:MGI:1349722]
poly(A) binding protein, cytoplasmic 2 Gene [Source:MGI Symbol;Acc:MGI:1349723]
poly(A) binding protein, cytoplasmic 6 Gene [Source:MGI Symbol;Acc:MGI:1914793]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa818 Nonsense Available for shipment Available now
sa6549 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032474 Nonsense 282 634 6 15
ENSDART00000143087 Nonsense 165 207 3 4

The following transcripts of ENSDARG00000021140 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 12756711)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12215057
KASP Assay ID:
554-0722.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTCAGAAAAAAGTGGAGCGTCAAACTGAGCTCAAGCGCAAATTTGAA[C/T]AGATGAAGCAAGACCGCATGACACGCTACCAGGTCAGTGAGACTGAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6549
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032474 Essential Splice Site 446 634 9 15
ENSDART00000143087   None 207 None 4

The following transcripts of ENSDARG00000021140 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 12752143)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12210489
KASP Assay ID:
554-4238.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTCAGACCAAGCCCCCGCTGGACCACACAAGGCGTCCGGCCTCAACG[C/T]AAGTCTATCMTTCATTCTAGAATCTTTTATCTACTTTTGAATTCAATATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link