gpr98

Ensembl ID:
ENSDARG00000021137
ZFIN ID:
ZDB-GENE-040624-6
Description:
G-protein coupled receptor 98 [Source:UniProtKB/Swiss-Prot;Acc:Q6JAN0]
Human Orthologue:
GPR98
Human Description:
G protein-coupled receptor 98 [Source:HGNC Symbol;Acc:17416]
Mouse Orthologue:
Gpr98
Mouse Description:
G protein-coupled receptor 98 Gene [Source:MGI Symbol;Acc:MGI:1274784]

Alleles

There are 14 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa941 Nonsense F2 line generated During 2014
sa14823 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18129 Essential Splice Site Available for shipment Available now
sa18818 Nonsense Mutation detected in F1 DNA During 2014
sa3569 Nonsense Mutation detected in F1 DNA During 2014
sa14200 Nonsense Available for shipment Available now
sa1078 Nonsense F2 line generated During 2014
sa10539 Nonsense Available for shipment Available now
sa20524 Nonsense Mutation detected in F1 DNA During 2014
sa3562 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6062 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15969 Nonsense Available for shipment Available now
sa20525 Nonsense Mutation detected in F1 DNA During 2014
sa20526 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa941
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 544 6198 9 90
Genomic Location:
Chromosome 5 (position 50523695)
KASP Assay ID:
554-0846.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCCTCTCCCTRAGCTTTCTCAGAGAAGGGGGGACTTTGGGAGAGGTA[C/T]GACTTACACTGACTGCCCTCTACATACCTGCCCGTCCACTGGACCCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14823
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Essential Splice Site 1632 6198 22 90
Genomic Location:
Chromosome 5 (position 50552765)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCAATGCTACAGGCTTYATCCTCTTCCAGYCGGGTCAGCTATCTGAG[G/A]TAACAGGATCAACTTGTCAAGCAGTTATTATTCATGACCACWAGACCACY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18129
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Essential Splice Site 1632 6198 22 90
Genomic Location:
Chromosome 5 (position 50552766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCAATGCKACAGGCTTYATCCTCTTCCAGYCGGGTCAGCTATCTGAGR[T/C]AACAGGATCAACTTGTCAAGCAGTTATTATTCATGACCACWAGACCACYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18818
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 1653 6198 23 90
ENSDART00000008043 Nonsense 1653 6198 23 90
Genomic Location:
Chromosome 5 (position 50556031)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTAGTTGTAAATGATGATCTTCCTGAAGTTGATGAGCACTTCCGGGTT[C/T]GACTGGTGTCTGCAAAATCAGGCGATGGCAAACCAGGTTCCACTCCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 1653 6198 23 90
ENSDART00000008043 Nonsense 1653 6198 23 90
Genomic Location:
Chromosome 5 (position 50556031)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTAGTTGTAAATGATGATCTTCCTGAAGTTGATGAGCACTTCCGGGTT[C/T]GACTGGTGTCTGCAAAATCAGGCGATGGCAAACCAGGTTCCACTCCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 1653 6198 23 90
ENSDART00000008043 Nonsense 1653 6198 23 90
Genomic Location:
Chromosome 5 (position 50556031)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTRGTTGTAAATGATGATCTTCCTGAAGTTKATGAGCACTTCCGGGTT[C/T]GAMTGGTGTCTGCAAAATCAGGCGATGGCAAACCAGGTTCCACTCCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1078
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 1823 6198 26 90
Genomic Location:
Chromosome 5 (position 50558128)
KASP Assay ID:
554-0980.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGYGGAAGTGGCGAGAGTGAAACTGACTTCTTTCTTCCGTCTTTTCACTA[T/A]CATCATGGTAAGATTCTTAAACTTGCTTGCCCTTTTTTCCTCTCACAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10539
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 1988 6198 28 90
Genomic Location:
Chromosome 5 (position 50562221)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCCRTGTGGCMGAAGCAAATGCTCTTGTTGCCCTAACCATACAGAGR[A/T]GAAAGGGCTTAATGGGAAGGGTACGAGTGGCMTATCGGACACTAAGGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20524
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 2578 6198 33 90
Genomic Location:
Chromosome 5 (position 50568640)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTTTTGCTCTACAGTATTAACCCTAATGCCACTCAGGAGGGTCTGTA[T/A]CTGGAAGTGAGGGAAGAACCTAAAACTACAGTGCTGCTGGTGATTGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3562
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Essential Splice Site 2949 6198 40 90
Genomic Location:
Chromosome 5 (position 50578547)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAATGCCAATGATGGAATCAGAGGAATCATTGGCTGGCAAAACATAGAG[T/A]ACAAAYTTCACTTCAACCNTTTTTTATTTAACACATGGTRTCTCTAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Essential Splice Site 4202 6198 62 90
Genomic Location:
Chromosome 5 (position 50600139)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGTTGTCATGAAAGATCGCCAGTCRGCTGCTACAATTCAACTGAAGG[T/A]AAAACTGAGCACTMCACMCAATTATTAAAARGTCTGAGGTCAGTAATCNCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15969
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 4479 6198 67 90
Genomic Location:
Chromosome 5 (position 50607957)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGATTTTTGAGTTGCAACTCACYGGTGCCACAGGAGGTGCCATACTT[G/T]GAGCTCAGCTAATTGCACGAATAACGATTGCCAAGAGTGACTCGCCAAAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20525
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 4763 6198 70 90
Genomic Location:
Chromosome 5 (position 50610703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATTCCCAAAACCAGTCAGTGGTTGTCAACGCTGCAGACCGAAGCAGA[C/T]AACTCATTATCAGCGTCAACAGGCTGGCAGGAGCTTTCGGCAATGCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20526
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 6093 6198 88 90
Genomic Location:
Chromosome 5 (position 50712066)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCACCGGTGCAGCTACTGTCGGCGGAGGAGAAATCAGCAAGTCTACG[C/T]AAAACCTCATCAGTGCCATGGAAGAGGTGTGTTCATTACCAAGGATCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rm4e86dr