tmem48

Ensembl ID:
ENSDARG00000021120
ZFIN ID:
ZDB-GENE-030131-7176
Description:
Nucleoporin NDC1 [Source:UniProtKB/Swiss-Prot;Acc:Q7SZC5]
Human Orthologue:
TMEM48
Human Description:
transmembrane protein 48 [Source:HGNC Symbol;Acc:25525]
Mouse Orthologue:
Tmem48
Mouse Description:
transmembrane protein 48 Gene [Source:MGI Symbol;Acc:MGI:1920037]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14041 Nonsense Available for shipment Available now
sa13501 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025120 Nonsense 95 671 4 18

The following transcripts of ENSDARG00000021120 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 26736215)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATTAACTTTTTTCTCTTCTCCCTCAAGTGGTTCCCTCAATTCCATGCT[C/A]GCGTGTGGCTCTTCTGGGRACGGTGCTTCACCCACTTCAATGTGTCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13501
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025120 Nonsense 335 671 10 18

The following transcripts of ENSDARG00000021120 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 26732422)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTTTGGCTCTGCAAGACCTGGCTTTATTGTCACAGCATTCTCCCTCA[C/T]GAAGACAGGAGGTTTTCAGTCTGAGTCAGCCAGGTGCAAACTAAAACCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/977fe6uo